Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 869436
End position: 869467
Length: 32

DNA sequence
>NC_013929, from 869436 to 869467 (32 bp); Streptomyces scabiei 87.22 GCGGGCCAGCGGGTCAGCCGGCCAGCGGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 869466-871523	Sequence	SCAB_7741 - hypothetical protein (Protein is coded in complementary strand; from 871523 to 869466)