Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8876022
End position: 8876045
Length: 24

DNA sequence
>NC_013929, from 8876022 to 8876045 (24 bp); Streptomyces scabiei 87.22 ACGCCGACGGCGACGACGATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8874690-8876495	Sequence	SCAB_80051 - hypothetical protein (Protein is coded in complementary strand; from 8876495 to 8874690)