Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9060236
End position: 9060265
Length: 30

DNA sequence
>NC_013929, from 9060236 to 9060265 (30 bp); Streptomyces scabiei 87.22 CCTCCTCTTCCTCCTCTTCCTCTTCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9060232-9061242	Sequence	SCAB_81711 - hypothetical protein (Protein is coded in complementary strand; from 9061242 to 9060232)