Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9102255
End position: 9102310
Length: 56

DNA sequence
>NC_013929, from 9102255 to 9102310 (56 bp); Streptomyces scabiei 87.22 TGACAAGTCGTCGATGACAAGTCGTCGATGACAAGGCATCGATGACAAGGCATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 9100429-9102294	Sequence	SCAB_82021 - glycosylhydrolase (Protein is coded in complementary strand; from 9102294 to 9100429)