Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9102321
End position: 9102362
Length: 42

DNA sequence
>NC_013929, from 9102321 to 9102362 (42 bp); Streptomyces scabiei 87.22 TCGATGACGAGGTGTCGATGACGAGGTGTCGATTACGAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 9102354-9103430	Sequence	SCAB_82031 - endo-1,4-beta-xylanase (Protein is coded in complementary strand; from 9103430 to 9102354)