Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9187025
End position: 9187069
Length: 45

DNA sequence
>NC_013929, from 9187025 to 9187069 (45 bp); Streptomyces scabiei 87.22 TGCCGATCGCCTGCGCGCCGATCGCCTGAGTGTCGATCACCTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9186952-9187080	Sequence	SCAB_82851 - hypothetical protein (Protein is coded in complementary strand; from 9187080 to 9186952)