Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9405912
End position: 9405953
Length: 42

DNA sequence
>NC_013929, from 9405912 to 9405953 (42 bp); Streptomyces scabiei 87.22 GTTCACTGCCGGGTGTTCACCGCCCGGTGTTCACCGCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 9405954-9406220	Sequence	SCAB_84201 - hypothetical protein (Protein is coded in complementary strand; from 9406220 to 9405954)