Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9416934
End position: 9416960
Length: 27

DNA sequence
>NC_013929, from 9416934 to 9416960 (27 bp); Streptomyces scabiei 87.22 CCGCCCGAGCCGCCCGAGCCGCCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9415998-9417065	Sequence	SCAB_84291 - hypothetical protein (Protein is coded in complementary strand; from 9417065 to 9415998)