Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9419674
End position: 9419736
Length: 63

DNA sequence
>NC_013929, from 9419674 to 9419736 (63 bp); Streptomyces scabiei 87.22 GACCGGGCAGACGGACGCACCGACCGGGCAGACGGACGCACCGACCGGACCGACGGCCGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 9418339-9419676	Sequence	SCAB_84321 - racemase
ORF. 9419673-9420503	Sequence	SCAB_84331 - oxidoreductase