Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9438970
End position: 9439023
Length: 54

DNA sequence
>NC_013929, from 9438970 to 9439023 (54 bp); Streptomyces scabiei 87.22 GCACCCGGTGAACCAGATGCACCCGGTGAACCAGATGCACCCGGTGAACCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 9437176-9438981	Sequence	SCAB_84511 - siderophore biosynthesis protein
ORF... 9438978-9440258	Sequence	SCAB_84521 - siderophore biosynthesis decarboxylase