Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9609973
End position: 9609996
Length: 24

DNA sequence
>NC_013929, from 9609973 to 9609996 (24 bp); Streptomyces scabiei 87.22 CGTCGCCGTCGTCGCCGCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9609723-9610550	Sequence	SCAB_85971 - sigma factor (Protein is coded in complementary strand; from 9610550 to 9609723)