Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9623129
End position: 9623152
Length: 24

DNA sequence
>NC_013929, from 9623129 to 9623152 (24 bp); Streptomyces scabiei 87.22 ACGCCGAAGCCGCCGCCGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9622400-9623869	Sequence	SCAB_86111 - lysine/ornithine decarboxylase (Protein is coded in complementary strand; from 9623869 to 9622400)