Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 963116
End position: 963142
Length: 27

DNA sequence
>NC_013929, from 963116 to 963142 (27 bp); Streptomyces scabiei 87.22 GTCCGTCGTGTCGGTCGTGTCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 961848-963878	Sequence	SCAB_8571 - tetracycline resistance protein (Protein is coded in complementary strand; from 963878 to 961848)