Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9650319
End position: 9650342
Length: 24

DNA sequence
>NC_013929, from 9650319 to 9650342 (24 bp); Streptomyces scabiei 87.22 TCCTGCTTCTGCTTCTGCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9649992-9650972	Sequence	SCAB_86381 - hypothetical protein (Protein is coded in complementary strand; from 9650972 to 9649992)