Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9694338
End position: 9694382
Length: 45

DNA sequence
>NC_013929, from 9694338 to 9694382 (45 bp); Streptomyces scabiei 87.22 GTCTTGGCCACGGCGGGCTTGGCCGTGGCGGTCTTGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9693933-9694727	Sequence	SCAB_86731 - regulatory protein (Protein is coded in complementary strand; from 9694727 to 9693933)