Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9829895
End position: 9829924
Length: 30

DNA sequence
>NC_013929, from 9829895 to 9829924 (30 bp); Streptomyces scabiei 87.22 CGGGGAGGGGCAGTGAGGGGCGGGTGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9829768-9830853	Sequence	SCAB_88151 - two-component system sensor kinase (Protein is coded in complementary strand; from 9830853 to 9829768)