Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 9953894
End position: 9953929
Length: 36

DNA sequence
>NC_013929, from 9953894 to 9953929 (36 bp); Streptomyces scabiei 87.22 CAGCCCTCGTCCCCGTCCTCGTCCGCGCCCTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 9953894-9954406	Sequence	SCAB_89231 - hypothetical protein (Protein is coded in complementary strand; from 9954406 to 9953894)