Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2845969
End position: 2846001
Length: 33

DNA sequence
>NC_014158, from 2845969 to 2846001 (33 bp); Tsukamurella paurometabola DSM 20162 GGTCGCGCCGCGGTGCCGCCGCGGGCGCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2845743-2846201	Sequence	Tpau_2741 - cold-shock DNA-binding domain-containing protein (Protein is coded in complementary strand; from 2846201 to 2845743)