Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2354310
End position: 2354345
Length: 36

DNA sequence
>NC_014158, from 2354310 to 2354345 (36 bp); Tsukamurella paurometabola DSM 20162 CGAGCCTCAGACGGGGCCTCAGACAGGGCCTCAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2353274-2354359	Sequence	Tpau_2262 - hypothetical protein
ORF... 2354341-2355186	Sequence	Tpau_2263 - MerR family transcriptional regulator (Protein is coded in complementary strand; from 2355186 to 2354341)