Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1098593
End position: 1098646
Length: 54

DNA sequence
>NC_014158, from 1098593 to 1098646 (54 bp); Tsukamurella paurometabola DSM 20162 GACGACGGTGCAGGCCGGGACGACGGTGCCGGTTGGGACGACGGTGCCGGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1098488-1099759	Sequence	Tpau_1074 - hypothetical protein (Protein is coded in complementary strand; from 1099759 to 1098488)