Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 119352
End position: 119387
Length: 36

DNA sequence
>NC_014158, from 119352 to 119387 (36 bp); Tsukamurella paurometabola DSM 20162 GCCGAGCATGTTGCCGAGGATGCTGCCGAGCAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 119269-119781	Sequence	Tpau_0109 - hypothetical protein (Protein is coded in complementary strand; from 119781 to 119269)