Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1265951
End position: 1266010
Length: 60

DNA sequence
>NC_014158, from 1265951 to 1266010 (60 bp); Tsukamurella paurometabola DSM 20162 CCGAAGAACGACGCCCCGAAGAACGACGCCCCGAAGAACGACGCCCCGAAGAACGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1265592-1267553	Sequence	Tpau_1233 - transcription termination factor Rho