Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1272635
End position: 1272658
Length: 24

DNA sequence
>NC_014158, from 1272635 to 1272658 (24 bp); Tsukamurella paurometabola DSM 20162 GACGTTGACGTAGGCGTTGACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1272429-1273280	Sequence	Tpau_1239 - hypothetical protein (Protein is coded in complementary strand; from 1273280 to 1272429)