Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1535728
End position: 1535754
Length: 27

DNA sequence
>NC_014158, from 1535728 to 1535754 (27 bp); Tsukamurella paurometabola DSM 20162 CCGCCGATCCCGACGATCTCGCCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1535710-1537125	Sequence	Tpau_1469 - bifunctional folylpolyglutamate synthase/ dihydrofolate synthase