Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1677629
End position: 1677673
Length: 45

DNA sequence
>NC_014158, from 1677629 to 1677673 (45 bp); Tsukamurella paurometabola DSM 20162 GGTGCCGACCCCGCTGGTGCCGACCCCGCTGGTGCCGACCCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1677005-1677805	Sequence	Tpau_1602 - hypothetical protein (Protein is coded in complementary strand; from 1677805 to 1677005)