Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1770987
End position: 1771010
Length: 24

DNA sequence
>NC_014158, from 1770987 to 1771010 (24 bp); Tsukamurella paurometabola DSM 20162 GGACCCCGACCCGGACACCGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1770056-1771912	Sequence	Tpau_1700 - sigma 54 interacting domain-containing protein