Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 1860509
End position: 1860532
Length: 24

DNA sequence
>NC_014158, from 1860509 to 1860532 (24 bp); Tsukamurella paurometabola DSM 20162 GGCGGCGGCGCCGGAGGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1859157-1862306	Sequence	Tpau_1783 - cell wall arabinan synthesis protein (Protein is coded in complementary strand; from 1862306 to 1859157)