Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2372961
End position: 2372984
Length: 24

DNA sequence
>NC_014158, from 2372961 to 2372984 (24 bp); Tsukamurella paurometabola DSM 20162 CCGAGCCCGAGAGCGAGCCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2372688-2373869	Sequence	Tpau_2280 - sodium/hydrogen exchanger (Protein is coded in complementary strand; from 2373869 to 2372688)