Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2392918
End position: 2392953
Length: 36

DNA sequence
>NC_014158, from 2392918 to 2392953 (36 bp); Tsukamurella paurometabola DSM 20162 GGCGAGGACCTCGGCGAGGGCGTCGACGAGGACGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2389673-2392984	Sequence	Tpau_2296 - exodeoxyribonuclease V subunit gamma (Protein is coded in complementary strand; from 2392984 to 2389673)