Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2397278
End position: 2397322
Length: 45

DNA sequence
>NC_014158, from 2397278 to 2397322 (45 bp); Tsukamurella paurometabola DSM 20162 GCTGCGTCCGGTGGTGCTGCTGCCGCTGGTGCTGCCGCCGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2397031-2397804	Sequence	Tpau_2303 - molybdate ABC transporter inner membrane protein