Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2534898
End position: 2534942
Length: 45

DNA sequence
>NC_014158, from 2534898 to 2534942 (45 bp); Tsukamurella paurometabola DSM 20162 ACGATGGTGCCCTCGACGATGGTGCCCTCGACGATGTCGCCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2533545-2535044	Sequence	Tpau_2435 - RNA binding S1 domain-containing protein (Protein is coded in complementary strand; from 2535044 to 2533545)