Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2633152
End position: 2633178
Length: 27

DNA sequence
>NC_014158, from 2633152 to 2633178 (27 bp); Tsukamurella paurometabola DSM 20162 GCCGACGAGGCCGGCGAGGTCGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2633141-2634157	Sequence	Tpau_2540 - glyceraldehyde-3-phosphate dehydrogenase (Protein is coded in complementary strand; from 2634157 to 2633141)