Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2838598
End position: 2838642
Length: 45

DNA sequence
>NC_014158, from 2838598 to 2838642 (45 bp); Tsukamurella paurometabola DSM 20162 GGTGGTCGTGGTCGTCGTAGTGGTGGTCGTGGTCGTCGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2837858-2839444	Sequence	Tpau_2733 - hypothetical protein (Protein is coded in complementary strand; from 2839444 to 2837858)