Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 2948493
End position: 2948537
Length: 45

DNA sequence
>NC_014158, from 2948493 to 2948537 (45 bp); Tsukamurella paurometabola DSM 20162 GGGCGCGGCCTTCTTGGCCGGAGCCTTCTTGGCCGGAGCCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2948401-2949108	Sequence	Tpau_2846 - histone family protein DNA-binding protein (Protein is coded in complementary strand; from 2949108 to 2948401)