Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3010013
End position: 3010048
Length: 36

DNA sequence
>NC_014158, from 3010013 to 3010048 (36 bp); Tsukamurella paurometabola DSM 20162 GCCGGGGTCTTCGCCGGTGTCTTGACCGGGGTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3009806-3010267	Sequence	Tpau_2901 - hypothetical protein (Protein is coded in complementary strand; from 3010267 to 3009806)