Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3087996
End position: 3088019
Length: 24

DNA sequence
>NC_014158, from 3087996 to 3088019 (24 bp); Tsukamurella paurometabola DSM 20162 GCGGGGGCAGGGGCGGGAGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3086712-3088103	Sequence	Tpau_2975 - cell wall hydrolase/autolysin (Protein is coded in complementary strand; from 3088103 to 3086712)