Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 31419
End position: 31442
Length: 24

DNA sequence
>NC_014158, from 31419 to 31442 (24 bp); Tsukamurella paurometabola DSM 20162 CGACCACGAGCAGGACCACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 29957-31471	Sequence	Tpau_0029 - penicillin-binding protein transpeptidase (Protein is coded in complementary strand; from 31471 to 29957)