Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 317711
End position: 317734
Length: 24

DNA sequence
>NC_014158, from 317711 to 317734 (24 bp); Tsukamurella paurometabola DSM 20162 GCGAGGGTGAGGCCGAGGACGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 317426-317962	Sequence	Tpau_0311 - hypothetical protein (Protein is coded in complementary strand; from 317962 to 317426)