Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 327832
End position: 327858
Length: 27

DNA sequence
>NC_014158, from 327832 to 327858 (27 bp); Tsukamurella paurometabola DSM 20162 GCGGCCTCTGCTGCCTCTGCGGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 327823-328044	Sequence	Tpau_0320 - hypothetical protein (Protein is coded in complementary strand; from 328044 to 327823)