Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3304214
End position: 3304237
Length: 24

DNA sequence
>NC_014158, from 3304214 to 3304237 (24 bp); Tsukamurella paurometabola DSM 20162 GCTGGAGCTGGAGCAGGAGCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3303541-3304719	Sequence	Tpau_3198 - D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding protein