Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3334587
End position: 3334640
Length: 54

DNA sequence
>NC_014158, from 3334587 to 3334640 (54 bp); Tsukamurella paurometabola DSM 20162 TCGGTCTCGGGCGCCTCGTCGGTCGCGGGCTCCTCGACGGTCGCGGGCTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3333438-3334895	Sequence	Tpau_3233 - transglycosylase domain-containing protein (Protein is coded in complementary strand; from 3334895 to 3333438)