Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3400872
End position: 3400934
Length: 63

DNA sequence
>NC_014158, from 3400872 to 3400934 (63 bp); Tsukamurella paurometabola DSM 20162 CCGTATCCCTGGGGCGCCTGGCCATAGCCCTGCGGGGCCTGGCCGTATCCCTGCGGCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3400038-3401093	Sequence	Tpau_3307 - antigen 34 kDa family protein (Protein is coded in complementary strand; from 3401093 to 3400038)