Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 3426437
End position: 3426496
Length: 60

DNA sequence
>NC_014158, from 3426437 to 3426496 (60 bp); Tsukamurella paurometabola DSM 20162 GGGCGTCTCGGCGGAGGGCGTCCCGGTCGAAGGCGTCTCGACTGAGGGCGTCTCGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3426279-3428153	Sequence	Tpau_3329 - hypothetical protein (Protein is coded in complementary strand; from 3428153 to 3426279)