Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 4143309
End position: 4143332
Length: 24

DNA sequence
>NC_014158, from 4143309 to 4143332 (24 bp); Tsukamurella paurometabola DSM 20162 TCCGGCTCAGGCTCCGGCTCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4143162-4145375	Sequence	Tpau_4016 - DNA polymerase III subunits gamma/tau (Protein is coded in complementary strand; from 4145375 to 4143162)