Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 4169914
End position: 4169937
Length: 24

DNA sequence
>NC_014158, from 4169914 to 4169937 (24 bp); Tsukamurella paurometabola DSM 20162 CGGCGGCCGCGGCGGCGTCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4169388-4170416	Sequence	Tpau_4039 - ATP dependent DNA ligase (Protein is coded in complementary strand; from 4170416 to 4169388)