Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 616863
End position: 616889
Length: 27

DNA sequence
>NC_014158, from 616863 to 616889 (27 bp); Tsukamurella paurometabola DSM 20162 ATCGCCGTGAGCGCCGTGATCGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 616806-616970	Sequence	Tpau_0592 - hypothetical protein (Protein is coded in complementary strand; from 616970 to 616806)