Sequence retrieval

Genome: Tsukamurella paurometabola DSM 20162
Start position: 833350
End position: 833394
Length: 45

DNA sequence
>NC_014158, from 833350 to 833394 (45 bp); Tsukamurella paurometabola DSM 20162 GGCTTCTGGGCAGCGGGCTTCTGGGCGGCGGGCTTCTGGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 833203-833871	Sequence	Tpau_0821 - transglycosylase domain-containing protein (Protein is coded in complementary strand; from 833871 to 833203)