Sequence retrieval

Genome: Thermosphaera aggregans DSM 11486
Start position: 484056
End position: 484079
Length: 24

DNA sequence
>NC_014160, from 484056 to 484079 (24 bp); Thermosphaera aggregans DSM 11486 TGTGGTTGTAGTGGTGGTTGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 483871-486078	Sequence	Tagg_0516 - metallophosphoesterase (Protein is coded in complementary strand; from 486078 to 483871)