Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 1082448
End position: 1082483
Length: 36

DNA sequence
>NC_014205, from 1082448 to 1082483 (36 bp); Staphylothermus hellenicus DSM 12710 GTAGTAGTGGTCGTGGTAGTAGTCGTAGTCGTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1082256-1085297	Sequence	Shell_1116 - solute binding protein-like protein (Protein is coded in complementary strand; from 1085297 to 1082256)