Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 1490318
End position: 1490380
Length: 63

DNA sequence
>NC_014205, from 1490318 to 1490380 (63 bp); Staphylothermus hellenicus DSM 12710 TTACCATTCTTCTTCTTCTTCCCACCACTCCTCTTCTTCTTCTTCCCATTCTTCTTCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1490319-1490414	Sequence	Shell_1562 - hypothetical protein (Protein is coded in complementary strand; from 1490414 to 1490319)